Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGGTAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTGGTGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTT
Nucleotide (GenBank) : M13616 Schizochytrium aggregatum 5S rRNA.
Nucleotide (GenBank) : X06104 Schizochytorium aggregatum 5S ribosomal RNA.
Honda D, et al. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 46: 637-647, 1999. PubMed: 10568038
Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 50: 129-140, 2009. PubMed: 18977305
