Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
CCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTGCTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGCTAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGGTCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTT
Nucleotide (GenBank) : KC146351 18S rRNA gene
Barclay WR. Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids. US Patent 5,130,242 dated Jul 14 1992
Jakobsen AN, et al. Endogenously synthesized (-)-proto-quercitol and glycine betaine are principal compatible solutes of Schizochytrium sp. strain S8 (ATCC 20889) and three new isolates of phylogenetically related thraustochytrids. Appl. Environ. Microbiol. 73: 5848-5856, 2007. PubMed: 17660311
