Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTGTTCCCTGCCCTCGCGGGTAGAAACGCCCACCCTTGTGTAATATATCATGTTGCTTTGGCAGGCCGCCCTCGGGCACCGGCTCCGGCCGGGTCGCGCCTGCCAGAGGACCCCAAACTCTGAATGTTAGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTAAACCAATCCAGCTTGCTGGGTCTTGGGCTCTCGCCTCCGGGCGGGCCTTAAAATCAGTGGCGGCGCCACCCGGCTCTAAGCGTAGTAATACTCCTCGCTACAGGGCTCCGGGTGGAGGCTGGCCAACAACCCCCAATTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA
Nucleotide (GenBank) : U33266 Zalerion arboricola pyrroline carboxylate reductase (P5CR) mRNA,
Nucleotide (GenBank) : ALVE00000000 Glarea lozoyensis ATCC 20868, whole genome shotgun sequencing project
Shinohara C, et al. Gypsetin, a new inhibitor of acyl-CoA:cholesterol acyltransferase produced by Nannizzia gypsea var. incurvata IFO 9228. I. Fermentation, isolation, physico-chemical properties and biological activity. J. Antibiot. 47: 163-167, 1994. PubMed: 8150711
Nuber B, et al. Gypsetin, a new inhibitor of acyl-CoA:cholesterol acyltransferase produced by Nannizzia gypsea var. incurvata IFO 9228. II. Structure determination. J. Antibiot. 47: 168-172, 1994. PubMed: 8150712
Giacobbe RA, et al. Antifungal fermentation product. US Patent 4,931,352 dated Jun 5 1990
Giacobbe RA, et al. Antibiotic agent produced by the cultivation of Zalerion microorganism in the presence of mannitol. US Patent 5,021,341 dated Jun 4 1991
Masurekar PS, et al. Pneumocandins from Zalerion arboricola. II. Modification of productspectrum by mutation and medium manipulation. J. Antibiot. 45: 1867-1874, 1992. PubMed: 1490877
Schwartz RE, et al. Pneumocandins from Zalerion arboricola. I. Discovery and isolation. J. Antibiot. 45: 1853-1866, 1992. PubMed: 1490876
Giacobbe RA, et al. Process for antifungal fermentation product. US Patent 4,968,608 dated Nov 6 1990
Fujimori F, Okuda T. Application of the random amplified polymorphic DNA using the polymerase chain reaction for efficient elimination of duplicate strains in microbial screening I. Fungi. J. Antibiot. 47: 173-182, 1994. PubMed: 8150713
Hensens OD, et al. Pneumocandins from Zalerion arboricola. III. Structure elucidation. J. Antibiot. 45: 1875-1885, 1992. PubMed: 1490878
Schmatz DM, et al. Pneumocandins from Zalerion arboricola. IV. Biological evaluation of natural and semisynthetic pneumocandins for activity against Pneumocystis carinii and Candida species. J. Antibiot. 45: 1886-1891, 1992. PubMed: 1490879
Adefarati AA, et al. Pneumocandins from Zalerion arboricola. V. Glutamic acid- and leucine-derived amino acids in pneumocandin A0 (L-671,329) and distinct origins of the substituted proline residues in pneumocandins A0 and B0. J. Antibiot. 45: 1953-1957, 1992. PubMed: 1362720
Bills GF, et al. Reclassification of a pneumocandin-producing anamorph, Glarea lozoyensis gen. et sp. nov., previously identified as Zalerion arboricola. Mycol. Res. 103: 179-192, 1999.
Lu P, et al. A gene (pks2) encoding a putative 6-methylsalicylic acid synthase from Glarea lozoyensis. Mol Genet Genomics 273: 207-216, 2005. PubMed: 15800788
Zhang A, et al. Efficient disruption of a polyketide synthase gene ( pks1) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol Genet Genomics 268: 645-655, 2003. PubMed: 12589439
