Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGCGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTCCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCCCTGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC
Nucleotide (GenBank) : KU729092 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU729195 D1/D2 region of 28S rRNA gene
Nucleotide (GenBank) : X93938 T.reesei rRNA genes and ITS1 and ITS2 DNA (strain ATCC 56765
Saddler JN, et al. Utilization of enzymatically hydrolyzed wood hemicelluloses by microorganisms for production of liquid fuels. Appl. Environ. Microbiol. 45: 153-160, 1983.
Saloheimo M, et al. A lignin peroxidase-encoding cDNA from the white-rot fungus Phlebia radiata: characterization and expression in Trichoderma reesei. Gene 85: 343-351, 1989. PubMed: 2628172
Bailey MJ, et al. Effect of pH on production of xylanase by Trichoderma reesei on xylan- and cellulose-based media. Appl. Microbiol. Biotechnol. 40: 224-229, 1993.
Kristufek D, et al. Coinduction of alpha-L-arabinofuranosidase and alpha-D-galactosidase formation in Trichoderma reesei RUT C-30. FEMS Microbiol. Lett. 115: 259-264, 1994.
Haab D, et al. Protein hypersecretory Trichoderma reesei mutant RUT C-30 displays increased ethanol and polyene resistance. J. Biotechnol. 29: 97-108, 1993.
Stralbrand H, et al. Purification and characterization of two beta-mannanases from Trichoderma reesei. J. Biotechnol. 29: 229-242, 1993.
Sundberg M, Poutanen K. Purification and properties of two acetylxylan esterases of Trichoderma reesei. Biotechnol. Appl. Biochem. 13: 1-11, 1991.
Saloheimo M, Niku-Paavola ML. Heterologous production of a ligninolytic enzyme: expression of the Phlebia radiata laccase gene in Trichoderma reesei. Bio-Technology 9: 987-990, 1991.
Nyyssonen E, et al. Efficient production of antibody fragments by the filamentous fungus Trichoderma reesei. Bio-Technology 11: 591-595, 1993. PubMed: 7763606
Kurzatkowski W, et al. Ultrastructural localization of cellular compartments involved in secretion of the low molecular weight, alkaline xylanase by Trichoderma reesei. Arch. Microbiol. 159: 417-422, 1993.
Poutanen K, et al. Deacetylation of xylans by acetyl esterases of Trichoderma reesei. Appl. Microbiol. Biotechnol. 33: 506-510, 1990.
Gamerith G, et al. Cellulase-poor xylanases produced by Trichoderma reesei RUT C-30 on hemicellulose substrates. Appl. Microbiol. Biotechnol. 38: 315-322, 1992.
Ehsani N, et al. Separation of enzymes produced by Trichoderma reesei with hydrophobic ultrafiltration membranes. Process Biochem. 31: 253-263, 1996.
Siika-Aho M, et al. An alpha-glucuronidase from Trichoderma reesei RUT C-30. Enzyme Microb. Technol. 16: 813-819, 1994.
Zeilinger S, et al. Conditions of formation, purification, and characterization of an alpha-galactosidase of Trichoderma reesei RUT C-30. Appl. Environ. Microbiol. 59: 1347-1353, 1993. PubMed: 8390816
Kadam KL, Keutzer WJ. Enhancement in cellulase production by Trichoderma reesei Rut-C30 due to citric acid. Biotechnol. Lett. 17: 1111-1114, 1995.
Watson TG, Nelligan I. Pilot scale production of cellulase by Trichoderma reesei (RUT C-30). Biotechnol. Lett. 5: 25-28, 1983.
Robison PD. Cellulase and xylanase production by Trichoderma reesei Rut C-30. Biotechnol. Lett. 6: 119-122, 1984.
Castillo FJ, et al. Lactase production in continuous culture by Trichoderma reesei Rut-C30. Biotechnol. Lett. 6: 593-596, 1984.
Kyriacou A, et al. Detection and characterization of the specific and nonspecific endoglucanases of Trichoderma reesei: evidence demonstrating endoglucanase activity by cellobiohydrolase II. Enzyme Microb. Technol. 9: 25-32, 1987.
Zhang L, et al. A novel host-vector system for heterologous protein co-expression and purification in the Trichoderma reesei industrial strain RUT-C30. Biotechnol. Lett. 38: 89-96, 2016. PubMed: 26343029
Sun A, et al. Expression of the mammalian peptide hormone obestatin in Trichoderma reesei. N. Biotechnol. 33: 99-106, 2016. PubMed: 26341165
Reilly MC, et al. Deletion of homologs of the SREBP pathway results in hyper-production of cellulases in Neurospora crassa and Trichoderma reesei. Biotechnol. Biofuels 8: 121, 2015. PubMed: 26288653
Chuang YC, et al. Trichoderma reesei meiosis generates segmentally aneuploid progeny with higher xylanase-producing capability. Biotechnol. Biofuels 8: 30, 2015. PubMed: 25729429
Smith W, et al. Comparison of intracellular and secretion-based strategies for production of human α-galactosidase A in the filamentous fungus Trichoderma reesei. BMC Biotechnol. 14: 91, 2014. PubMed: 25344685
Okeke BC. Cellulolytic and xylanolytic potential of high β-glucosidase-producing Trichoderma from decaying biomass. Appl. Biochem. Biotechnol. 174: 1581-1598, 2014. PubMed: 25129039
Valkonen M, Penttil? M, Ben?ina M. Intracellular pH responses in the industrially important fungus Trichoderma reesei. Fungal Genet. Biol. 70: 86-93, 2014. PubMed: 25046860
Jovanovi? B, Mach RL, Mach-Aigner AR. Erythritol production on wheat straw using Trichoderma reesei. AMB Express 4: 34, 2014. PubMed: 24949268
Rana V, et al. On-site enzymes produced from Trichoderma reesei RUT-C30 and Aspergillus saccharolyticus for hydrolysis of wet exploded corn stover and loblolly pine. Bioresour. Technol. 154: 282-289. 2014. PubMed: 24412480
Marx IJ, et al. Comparative secretome analysis of Trichoderma asperellum S4F8 and Trichoderma reesei Rut C30 during solid-state fermentation on sugarcane bagasse. Biotechnol. Biofuels 6: 172, 2013. PubMed: 24286470
Anderson LN, et al. Activity-based protein profiling of secreted cellulolytic enzyme activity dynamics in Trichoderma reesei QM6a, NG14, and RUT-C30. Mol. Biosyst. 9: 2992-3000, 2013. PubMed: 24121482
Peterson R, Nevalainen H. Trichoderma reesei RUT-C30--thirty years of strain improvement. Microbiology 158: 58-68, 2012. PubMed: 21998163
