Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AAGGATCATTAGTGAAGATTTGGGCCAGCCATACGGACGCTACCGCGTCTCTGGCGCCCACCACTATATCCACACCAACCCCTGTGCACTGTGATGGCGAAAGTCATCGAACCAAAAAAACTCGTATGGTTGTATGTACGTGAAACTGTAGGCTTTGCCTACGAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCTCCCCATACGGTGGCCGAAAGGCCGGAGTATGGCGGACGGGGTTGGATGGGTGCCGCTGCCTGGGAAACCAGGCTCGCCCGAAATGCATAAGCGCCAGGACCCTCGCTACTGCCCTCTAGGGAAGGGCGGCTGAGCGACCGCTGAGCATGGCATGATACGTCATTTGCTGTGTGTGGGCGGCCGGTTGGAGAGGTGTCTGCTTTATACAGCCCTTTTTATTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAG
Nucleotide (GenBank) : BCKX00000000 Malassezia dermatis strain JCM 11348, whole genome shotgun sequencing project
Sugita T, et al. New yeast species, Malassezia dermatis, isolated from patients with atopic dermatitis. J. Clin. Microbiol. 40(4): 1363-1367, 2002. PubMed: 11923357
Caba?es FJ, et al. Two New lipid-dependent Malassezia species from domestic animals. FEMS Yeast Res. 7(6): 1064-1076, 2007. PubMed: 17367513
Gaitanis G, Robert V, Velegraki A. Verifiable single nucleotide polymorphisms of the internal transcribed spacer 2 region for the identification of 11 Malassezia species. J. Dermatol. Sci. 43(3): 214-217, 2006. PubMed: 16797927
Castellá G, Coutinho SD, Caba?es FJ. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis. Med. Mycol. 52: 99-105, 2014. PubMed: 23902157
Wang QM, et al. Multigene phylogeny and taxonomic revision of yeasts and related fungi in the Ustilaginomycotina. Stud. Mycol. 81: 55-83, 2015. PubMed: 26955198
