Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
AAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA
Nucleotide (GenBank) : HQ026738 ITS including 5.8S rRNA gene
Kumeda Y, Asao T. Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl. Environ. Microbiol. 62: 2947-2952, 1996. PubMed: 8702288
ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.
ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.
RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.
U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961
U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956
U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000
Schmidt E, French DW. Two-day mold testing using a contact agar method. For. Prod. J. 29: 39-42, 1979.
Yamaguchi I, et al. Isolation and purification of blasticidin S deaminase from Aspergillus terreus. J. Antibiot. 28: 7-14, 1975. PubMed: 236272
Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.
Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.
Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.
Adhesives for load-bearing timber structures --- Casein adhesives --- Classification and performance requirements, Annex B. London, UK:British Standards Institution;British Standard BS EN 12436:2002.
Kiyota T, et al. Aflatoxin non-productivity of Aspergillus oryzae caused by loss of function in the aflJ gene product. J. Biosci. Bioeng. 111: 512-517, 2011. PubMed: 21342785
