Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
TTGTTTGGGGCAGTCACGGAGCTCTTCTTTTCCCCACTCCTCCCCCGCCGTTCCATCTCCAACGTGATCAACATGACAATGCTAACTCCCTCAAGGTGCACCTCCAAACTGGCCAGTGTGTAAGTAAACCACTTGCAATATTTGATGGAAGATAACTGAGTCATCGCGCTCTTTTTATAGGGTAACCAAGTTGGTACCGCCTTCTGGTAAGTCCAATATTGATCCATCCTTTTCACATGCTTAACAGGCAGGGTGTTTTTAATGGAACGCATATTGACGTTTTTAAGGCAAATAATCTCTGGCGAACATGGCCTCGACGCGTCTGGAGTGTGAGTAACATGAGCTATGACGTGACGGACTTCTCCTAATTGATTCTCAGGTACACTGGCTCCAACGACCAAGAACTGGAGCGGATGAATGTCTATTTCAATGAGGTAGCTAAGCTTCTCTAAATCGTGTGTACTACTGCCGCTCACCAATCCACTAGGTCGGCAACCAGAAATATGTTCCCCGCGCGGTCCTCGTGGACTTGGAGCCCGGCACGATGGACGCCGTCCGTGCTGGTCCGTTTGGACAGCTTTTCCGACCGGACAACTTCGTATTCGGCCAGTCAAGCGCGGGAAATAACTGG
Samson RA, Gams W. Typification of the species of Aspergillus and associated teleomorphs In Samson RA, Gams W. Advances in Penicillium and Aspergillus systematics. New York, Plenum Press pp. 31-54, 1985.
Kumeda Y, Asao T. Single-strand conformation polymorphism analysis of PCR-amplified ribosomal DNA internal transcribed spacers to differentiate species of Aspergillus section Flavi. Appl. Environ. Microbiol. 62: 2947-2952, 1996. PubMed: 8702288
Underkofler LA, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry: use of mold amylase. Ind. Eng. Chem. 31: 734-738, 1939.
Rodriguez A, et al. Real-time PCR assays for detection and quantification of aflatoxin-producing molds in foods. Food Microbiol. 31: 89-99, 2012. PubMed: 22475946
Goncalves SS, et al. Molecular phylogeny and phenotypic variability of clinical and environmental strains of Aspergillus flavus. Fungal Biol. 116: 1146-1155, 2012. PubMed: 23153805
Kiyota T, et al. Aflatoxin non-productivity of Aspergillus oryzae caused by loss of function in the aflJ gene product. J. Biosci. Bioeng. 111: 512-517, 2011. PubMed: 21342785
Pildain MB, et al. Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts. Int. J. Syst. Evol. Microbiol. 58: 725-735, 2008. PubMed: 18319485
Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197
Lee CZ, Liou GY, Yuan GF. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152: 161-170, 2006. PubMed: 16385126
Kumeda Y, Asao T. Heteroduplex panel analysis, a novel method for genetic identification of Aspergillus Section Flavi strains. Appl. Environ. Microbiol. 67: 4084-4090, 2001. PubMed: 11526009
Geiser DM, Pitt JI, Taylor JW. Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus. Proc. Natl Acad. Sci. USA 95: 388-393, 1998. PubMed: 9419385
type of Eurotium oryzae
