Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
CATTACTGAGTGAGGGTCCCTCGGGGCCCAACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGAGCCCGCCCCCCTTCCTTAGGGGTGGCACAGCGCTCGCCGGAGACACCAACGTGAACACTGTCTGAAGTTTTGTCGTCTGAGTCGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCACCCCCTGGTATTCCGGGGGGTATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTTGTAGGCCCGGCCGGCTGCTGGCCGACGCTGAAAAGCAACCAATCTATTTCATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
AATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCCTCGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCCGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCACCCTTCGGGGTGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACG
Nucleotide (GenBank) : LKBE00000000 Aspergillus westerdijkiae strain CBS 112803, whole genome shotgun sequencing project
Visagie CM, et al. Ochratoxin production and taxonomy of the yellow aspergilli (Aspergillus section Circumdati). Stud. Mycol. 78: 1–61, 2014. PubMed: 25492980
Frisvad JC, et al. New ochratoxin A producing species of Aspergillus section Circumdati. Stud. Mycol. 50: 23–43, 2004.
Xiao H, et al. Metabolites of ochratoxins in rat urine and in a culture of Aspergillus ochraceus. Appl. Environ. Microbiol. 62: 648-655, 1996. PubMed: 8593066
Paster N, et al. Effect of gamma radiation on ochratoxin production by the fungus Aspergillus ochraceus. J. Sci. Food Agric. 36: 445-449, 1985.
Schwartz RE, et al. L-657,398, a novel antifungal agent: fermentation, isolation, structural elucidation and biological properties. J. Antibiot. 41: 1774-1779, 1988. PubMed: 3209471
El-Gendy SM, Marth EH. Heat-stability of peroxidase in mycelia of some toxigenic and nontoxigenic aspergilli and penicillia. Mycopathologia 73: 25-28, 1981. PubMed: 6783912
Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979.
Sansing GA, et al. Rapid method for preparing cell-free extracts of Aspergillus ochraceus. Appl. Microbiol. 29: 300-302, 1975. PubMed: 1115500
Wu MT, Ayres JC. Effects of dichlorvos on ochratoxin production by Aspergillus ochraceus. J. Agric. Food Chem. 22: 536-537, 1974. PubMed: 4840523
Doster RC, et al. Comparative toxicity of ochratoxin A and crude Aspergillus ochraceus culture extract in Japanese quail (Coturnix coturnix japonica). Poultry Sci. 52: 2351-2353, 1973. PubMed: 4789009
Cole RJ, et al. 4-Hydroxymellein: a new metabolite of Aspergillus ochraceus. J. Agric. Food Chem. 19: 909-911, 1971.
Davis ND, et al. Production of ochratoxin A by Aspergillus ochraceus in a semisynthetic medium. Appl. Microbiol. 17: 742-744, 1969. PubMed: 5785958
Searcy JW, et al. Biosynthesis of ochratoxin A. Appl. Microbiol. 18: 622-627, 1969. PubMed: 5369298
Bacha N, et al. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae. Fungal Genet Biol 46: 742-749, 2009. PubMed: 19589392
Gil-Serna J, et al. Discrimination of the main Ochratoxin A-producing species in Aspergillus section Circumdati by specific PCR assays. Int J Food Microbiol 136: 83-87, 2009. PubMed: 19819579
Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197
Varga J, et al. Molecular analysis of variability within the toxigenic Aspergillus ochraceus species. Can J Microbiol 46: 593-599, 2000. PubMed: 10932351
