Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
After 5-7 days colonies yellowish-green; conidial heads radiate, conidiogenous cells uni- and biseriate; conidiophore stipes rough-walled, hyaline; vesicles spherical; conidia echinulate, (sub)spherical, 3.5 μm diam.
CTTCCGTAGGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAT
Nucleotide (GenBank) : JQ070072 ITS including 5.8S rRNA gene
Meded. Fac. Landbouwwet. Univ. Gent 59/4b: 2471-2473, 1994.
Underkofler LA, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry: use of mold amylase. Ind. Eng. Chem. 31: 734-738, 1939.
Schoene L, et al. Saccharification of starchy grain mashes for the alcoholic fermentation industry. Comaprison of several saccharifying agents. Ind. Eng. Chem. 32: 544-547, 1940.
Hao LC, et al. Fungal amylases as saccharifying agents in the alcoholic fermentation of corn. Ind. Eng. Chem. 35: 814-818, 1943.
Murado MA, et al. Characterization of microbial biomasses and amylolytic preparations obtained from mussel processing waste treatment. Bioresour. Technol. 43: 117-125, 1993.
