Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCCTAGCTAAACCGGATTGTAGACTGTAGAAGTGTTTTCCAGGCAAGCCGAGTAAATAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGGCTTGAGCATTTGCCTTTTGTGATACGCTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAACCGTTTGGAGCCAGACTGGCTTGTCTGTAATCAATCTAGGCTTCGGCCTGGATGCACTTGCAGGCTATGCCTGCCAACGACAATTTGACTTGAGGGAAAAAACTAGGGGAAATGTGGCCCACTTGTGGGTGTTATAGTCCCTTAGAAAATACCTTGGGTTGGATTGAGGAACGCAGCGAATGCTTATTGGCGAGTTTTCCAGGAAGGTTTTCTGAGGTACTACGGTATCAAGGTTGATCTTTTTGGTTATACTTCTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC
Nucleotide (GenBank) : AF226154 lactate dehydrogenase (ldhA) gene, complete coding sequence
Nucleotide (GenBank) : AF226155 lactate dehydrogenase (ldhB) gene, complete coding sequence
Goldberg I, Stieglitz B. Improved rate of fumaric acid production by Tweens and vegetable oils in Rhizopus arrhizus. Biotechnol. Bioeng. 27: 1067-1069, 1985.
Zilliken FW. Ergostadienetriols, compositions containing same, and methods of preparing and using same. US Patent 4,234,577 dated Nov 18 1980
Soccol CR, et al. Potential of solid state fermentation for production of L(+)-lactic acid by Rhizopus oryzae. Appl Microbiol Biotechnol 41: 286-290, 1994.
Yu RC, Hang YD. Purification and characterization of NAD-dependent lactate dehydrogenase from Rhizopus oryzae. Food Chem. 41: 219-225, 1991.
Skory CD. Isolation and expression of lactate dehydrogenase genes from Rhizopus oryzae. Appl. Environ. Microbiol. 66: 2343-2348, 2000. PubMed: 10831409
Skory CD. Fungal lactate dehydrogenase gene and constructs for the expression thereof. US Patent 6,368,189 dated Jul 31 2001
Hang YD. Direct fermentation of corn to L(+)-lactic acid by Rhizopus oryzae. Biotechnol. Lett. 11: 299-300, 1989.
Hang YD, et al. Production of L(+)-lactic acid by Rhizopus oryzae immobilized in calcium alginate gels. Biotechnol. Lett. 11: 119-120, 1989.
Yu RC, Hang YD. Kinetics of direct fermentation of agricultural commodities to L(+)-lactic acid by Rhizopus oryzae. Biotechnol. Lett. 11: 597-600, 1989.
Yu RC, Hang YD. Amylolytic enzyme production by Rhizopus oryzae grown on agricultural commodities. World J. Microbiol. Biotechnol. 6: 15-18, 1990.
Hang YD. Chitosan production from Rhizopus oryzae mycelia. Biotechnol. Lett. 12: 911-912, 1990.
Soccol CR, et al. Production of L-lactic acid by Rhizopus species. World J. Microbiol. Biotechnol. 10: 433-435, 1994.
Pritchard GG. Factors affecting the activity and synthesis of NAD-dependent lactate dehydrogenase in Rhizopus oryzae. J. Gen. Microbiol. 78: 125-137, 1973.
Ward GE, et al. Biochemical studies in the genus Rhizopus. I. The production of dextro-lactic acid. J. Am. Chem. Soc. 58: 1286-1288, 1936.
Gryganskyi AP, et al. Structure, function, and phylogeny of the mating locus in the Rhizopus oryzae complex. PLoS One 5: e15273, 2010. PubMed: 21151560
Skory CD, et al. Analysis of a functional lactate permease in the fungus Rhizopus. Enzyme Microb Technol 46: 43-50, 2010.
Mertens JA, Skory CD. Isolation and characterization of a second glucoamylase gene without a starch binding domain from Rhizopus oryzae. Enzyme Microb Technol 40: 874-880, 2007.
Mertens JA, Skory CD, Ibrahim AS. Plasmids for expression of heterologous proteins in Rhizopus oryzae. Arch Microbiol 186: 41-50, 2006. PubMed: 16804680
Saito K, et al. Genetic diversity in Rhizopus oryzae strains as revealed by the sequence of lactate dehydrogenase genes. Arch Microbiol 182: 30-36, 2004. PubMed: 15278242
Abe A, et al. rDNA ITS sequence of Rhizopus oryzae: its application to classification and identification of lactic acid producers. Biosci Biotechnol Biochem 67: 1725-1731, 2003. PubMed: 12951506
Skory CD. Induction of Rhizopus oryzae pyruvate decarboxylase genes. Curr Microbiol 47: 59-64, 2003. PubMed: 12783195
Skory CD. Homologous recombination and double-strand break repair in the transformation of Rhizopus oryzae. Mol Genet Genomics 268: 397-406, 2002. PubMed: 12436261
