Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGCTGCAAAACTCCCTAAACCATCGTGAACGCTACCTAGACCGTTGCTTCGGCGGGCGGCGCCCTCGCGCGCCCCCCCTGGGGCCCGCACCGCGGGCGCCCGCCGGAGGTACACCAAACTCTTGATATGTTATGGCCACTCTGAGTCTCCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCATCAAGCCCACGGCTTGTGTTGGGGACCTGCGGCTGCCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACACCGGGCGTAGTAGCATACGACCTCGCTCAGGGCGTGCTGCGGGTTCCAGCCGTAAAACGACCTTCACAACCCAAGGTTGACCTCGGATCAGGTAGGAGGACCCGCTGAACTTAAGCATATCAATAA
Canevascini G, et al. Cellobiose dehydrogenases of Sporotrichum (Chrysosporium) thermophile. Eur. J. Biochem. 198: 43-52, 1991. PubMed: 1645650
. . Ber. Schweiz. Bot. Ges. 90: 108-117, 1980.
Carrel FL, Canevascini G. Effect of beta-glucosidase inhibitors on synthesis of cellulase and beta-glucosidase in Sporotrichum (Chrysosporium) thermophile. Can. J. Microbiol. 37: 459-464, 1991.
Canevascini G, Meyer HP. beta-Glucosidase in the cellulolytic fungus Sporotrichum thermophile Apinis. Exp. Mycol. 3: 203-214, 1979.
Coudray MR, et al. Characterization of a cellobiose dehydrogenase in the cellulolytic fungus Sporotrichum (Chrysosporium) thermophile. Biochem. J. 203: 277-284, 1982. PubMed: 7103940
Meyer HP, Canevascini G. Separation and some properties of two intracellular beta-glucosidases of Sporotrichum (Chrysosporium) thermophile. Appl. Environ. Microbiol. 41: 924-931, 1981.
van den Brink JJ, et al. Phylogeny of the industrial relevant, thermophilic genera Myceliophthora and Corynascus. Fungal Divers 52: 197-207, 2012.
Tambor JH, et al. Recombinant expression, activity screening and functional characterization identifies three novel endo-1,4-beta-glucanases that efficiently hydrolyse cellulosic substrates. Appl. Microbiol. Biotechnol. 93: 203-214, 2012. PubMed: 21710260
Berka RM, et al. Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris. Nat. Biotechnol. 29: 922-927, 2011. PubMed: 21964414
