Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATTAGGGTGTCCAACTTAACTTGGAGCCCGACCCTCACTTTCTAACCCTGTGCATTTGTCTTGGGTAGTAGCTTGCGTCAGCGAGCGAATCCCATTTCACTTACAAACACAAAGTCTATGAATGTAACAAATTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATTCTTCAACCCACCTCTTTCTTAGTGAATCAGGCGGTGTTTGGATTCTGAGCGCTGCTGGCTTCGCGGCCTAGCTCGCTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTCGGCGTAATAGACTATTCGCTGAGGATTCTGGTCTCTGACTGGAGCCGGGTAAGGTTAAAGGGAGCTACTAATCCTCATGTCTATCTTGAGATTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGATACCCCATTACACGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGGCTTGCTCGGTTTGCAGGCCAGCATCAGTTTTCCGGGGCGGATAATGGCAGTTAGAATGTAGCAGTCTCGGCTGTGTTATAGCTTTCTGCTGGATACGTCCTGGGGGACTGAGGAACGCAGCGTGCCGTATGGCGAGGGCTTCGGTCCTTTCACGCTTAGGATGATGATGGAATGGCTTTAAACGAC
Nucleotide (GenBank) : E01783 DNA sequence coding for L-phenylalanine ammonialyase.
Nucleotide (GenBank) : E01784 DNA sequence coding for L-phenylalanine ammonialyase.
Nucleotide (GenBank) : E01785 DNA sequence coding for L-plenylalanine ammonialyase.
Nucleotide (GenBank) : LCTU00000000 Rhodosporidium toruloides strain IFO0559, whole genome shotgun sequencing project
Nucleotide (GenBank) : BCIY00000000 Rhodotorula toruloides strain JCM 10020, whole genome shotgun sequencing project
Nucleotide (GenBank) : LNQQ00000000 Rhodotorula toruloides strain ATCC 10788, whole genome shotgun sequencing project
Hu J, Ji L. Draft genome sequences of Rhodosporidium toruloides strains ATCC 10788 and ATCC 10657 with compatible mating types. Genome Announc 4: e00098-16, 2016. PubMed: 26966203
Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940
Coelho MA, et al. Identification of mating type genes in the bipolar basidiomycetous yeast Rhodosporidium toruloides: first insight into the MAT locus structure of the Sporidiobolales. Eukaryot. Cell 7: 1053-1061, 2008. PubMed: 18408057
Matheny PB, et al. Resolving the phylogenetic position of the Wallemiomycetes: an enigmatic major lineage of Basidiomycota. Can J Bot 84: 1794-1805, 2006.
Tanabe Y, Watanabe MM, Sugiyama J. Are Microsporidia really related to Fungi?: a reappraisal based on additional gene sequences from basal fungi. Mycol. Res. 106: 1380-1391, 2002.
Grange LM, et al. Effect of various nutrient limitations on fatty acid production by Rhodotorula glutinis. Appl Microbiol Biotechnol 38: 784-789, 1993.
Adachi O, et al. Crystallization and properties of L-phenylalanine ammonia-lyase from Rhodosporidium toruloides. Agric Biol Chem 54: 2839-2843, 1990.
Hodgins DS. Yeast phenylalanine ammonia-lyase. Purification, properties, and the identification of catalytically essential dehydroalanine. J. Biol. Chem. 246: 2977-2985, 1971. PubMed: 5102931
Turcotte G, Kosaric N. Biosynthesis of lipids by Rhodosporidium toruloides ATCC 10788. J Biotechnol 8: 221-238, 1988.
Yoon SH, Rhee JA. Quantitative physiology of Rhodotorula glutinis for microbial lipid production. Process Biochem. 18(5): 2-4, 1983.
Yoon SH, Rhee JS. Lipid from yeast fermentation: Effects of cultural conditions on lipid production and its characteristics of Rhodotorula glutinis. J. Am. Oil Chem. Soc. 60: 1281-1286, 1983.
Fujishima T, et al. Distribution of Phosphodiesterase in bacteria, yeast and actinomycetes [in Japanese]. Hakkokogaku 58: 349-353, 1980.
Banno I. Studies on the sexuality of Rhodotorula. J. Gen. Appl. Microbiol. 13: 167-196, 1967.
Yoon SH, et al. Effect of carbon and nitrogen sources on lipid production of Rhodotorula gracilis. J. Ferment. Technol. 60: 243-246, 1982.
Ogata K, et al. Method for the production of 5'-nucleotides. US Patent 3,139,385 dated Jun 30 1964
type strain of Rhodotorula gracilis
<td id="dalza"></td>
<dfn id="dalza"></dfn>
<dfn id="dalza"></dfn>