Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AGGTGAACCTGCGGAAGGATCATTAGAGATGTGCGCAAGCACTTTTCCCTTCACACACCTGTGCACCGTGGTCTCCGGACCTACAAACATGAAGTCATGAACGTCTTATTATTATAACAAAATAAAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATGAAAATCTCATCCCATCGGGTTTCCGATGATGATGGACTTGGGTGTTGCCGTCCTTGGCTCGCCTTAAAGGTGTTAGCGGTTCCGAAGTCGAATCTGGCGTAATAAGTTTCGCTGGCCTAGATCGAAGGCTGCTCCTAACCCGTCTTCTGACATTTTTTGCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT
Nucleotide (GenBank) : AF189835 26S ribosomal RNA gene, partial sequence
Nucleotide (GenBank) : EU252549 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : BCHT00000000 Cryptococcus skinneri strain JCM 9039, whole genome shotgun sequencing project
Phaff HJ, do Carmo-Sousa L. Four new species of yeast iosolated from insect frass in bark of Tsuga heterophylla (Raf.) Sargent. Antonie van Leeuwenhoek 28: 193-207, 1962.
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Liu XZ, et al. Phylogeny of tremellomycetous yeasts and related dimorphic and filamentous basidiomycetes reconstructed from multiple gene sequence analyses. Stud Mycol 81: 1-26, 2015. PubMed: 26955196
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
Takashima M, Nakase T. Molecular phylogeny of the genus Cryptococcus and related species based on the sequences of 18S rDNA and internal transcribed spacer regions. Microbiol Cult Collect 15: 35-47, 1999.
