Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTGGCAGCCTCCGGTTGTCCGAGTTGTAAACTAGAGAAGCGTTTTCCGTGCCGGCCTGTGTACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACACAGACCACCGGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCGTGCTCGGACTCAGCTGGGTTCGTCCCAGTCTATTTCCGGGTGCCGCAGGTCAGCATCAGTTTCGGGCGGTGGAAAACGGGCGGGGGAAGGTGGCATCTCCGGATGTGTTATAGCCCCCGTTTGGATGCATCGCGTGGGACTGAGGAACGCAGCGCGCCCTTCACGGGGTCGGTCTCCGGACACGAACGCGCTTAGGATGCTGGCATAATGGCTTTAAACGAC
Nucleotide (GenBank) : AF139634 nucleotide sequence of intergenic spacer
Nucleotide (GenBank) : AF189871 26S ribosomal RNA gene, partial sequence
Nucleotide (GenBank) : AF139629 nucleotide sequence of internal transcribed spacer
Johnson EA, et al. Processes for in vivo production of astaxanthin and Phaffia rhodozyma yeast of enhanced astaxanthin content. US Patent 5,356,809 dated Oct 18 1994
Golubev WI. Perfect state of Rhodomyces dendrorhous (Phaffia rhodozyma). Yeast 11: 101-110, 1995. PubMed: 7732720
Miller MW, et al. Phaffia, a new yeast genus in the Deuteromycotina (Blastomycetes). Int. J. Syst. Bacteriol. 26: 286-291, 1976.
. . Biotechnol. Lett. 17: 575-578, 1995.
Hayman GT, et al. Production of carotenoids by Phaffia rhodozyma grown on media composed of corn wet-milling co-products. J. Ind. Microbiol. 14: 389-395, 1995.
Tilser I, et al. Effect of supplementation of University of Wisconsin solution with glycoproteins from psychrophilic strains of yeast on hypothermic liver storage of rats. Cryobiology 33: 347-353, 1996. PubMed: 8689892
Breierova E. Cryoprotection of psychrophilic yeast species- by the use of additives with croprotective media. Cryo-Lett. 15: 191-197, 1994.
Fell JW, Blatt GM. Separation of strains of the yeasts Xanthophyllomyces dendrorhous and Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J. Ind. Microbiol. Biotechnol. 23: 677-681, 1999. PubMed: 10455500
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Calo P, et al. Mevalonic acid increases trans-astaxanthin and carotenoid biosynthesis in Phaffia rhodozyma. Biotechnol Lett 17: 575-578, 1995.
David-Palma M, Libkind D, Sampaio JP. Global distribution, diversity hot spots and niche transitions of an astaxanthin-producing eukaryotic microbe. Mol Ecol 23: 921-932, 2014. PubMed: 24372735
Hara KY, et al. Evaluation and screening of efficient promoters to improve astaxanthin production in Xanthophyllomyces dendrorhous. Appl Microbiol Biotechnol 98: 6787-6793, 2014. PubMed: 24737060
Loto I, et al. Enhancement of carotenoid production by disrupting the C22-sterol desaturase gene (CYP61) in Xanthophyllomyces dendrorhous. BMC Microbiol 12: 235, 2012. PubMed: 23075035
Linde D, et al. Molecular and biochemical characterization of a beta-fructofuranosidase from Xanthophyllomyces dendrorhous. Appl Environ Microbiol 75: 1065-1073, 2009. PubMed: 19088319
Libkind D, et al. Biogeography, host specificity, and molecular phylogeny of the basidiomycetous yeast Phaffia rhodozyma and its sexual form, Xanthophyllomyces dendrorhous. Appl Environ Microbiol 73: 1120-1125, 2007. PubMed: 17189439
Fell JW, et al. Molecular diversity and intragenomic variability in the yeast genus Xanthophyllomyces: the origin of Phaffia rhodozyma? FEMS Yeast Res 7: 1399-1408, 2007. PubMed: 17825066
type strain of Phaffia rhodozyma
