<sup id="sxxxb"></sup>
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCCCCTGGAATGGGGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTTTGTGATGCACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCRCGTCTGCCAGGGATCAACCTTACTTTTGTGAGGCGTACTTCCTGGTTGATGGGTCAGCATCAGTTTTGGTTGCTGGATAAAGGTCAGAGAAATGTGGCACCTTCGGGTGTGTTATAGTCTTTGATCAGATACAGTGGCTGGGACTGAGGAACTCAGCGCCGCAAGGCTGTCTTAGGATGCTGGCAAAATGGCTTTAATCGAC
Nucleotide (GenBank) : AF007221 Pleurotus eryngii polyvalent peroxidase MnPL1 precursor (mnpl)
Nucleotide (GenBank) : AF007222 Pleurotus eryngii polyvalent peroxidase MnPL2 precursor (mnpl)
Nucleotide (GenBank) : AF007223 Pleurotus eryngii polyvalent peroxidase MnPL1 precursor (mnpl)
Nucleotide (GenBank) : AF007224 Pleurotus eryngii polyvalent peroxidase MnPL2 precursor (mnpl)
Guillen F, et al. Substrate specificity and properties of the aryl-alcohol oxidase from the ligninolytic fungus Pleurotus eryngii. Eur. J. Biochem. 209: 603-611, 1992. PubMed: 1425667
Ruiz-Duenas FJ, Martinez MJ. Enzymatic activities of Trametes versicolor and Pleurotus eryngii implicated in biocontrol of Fusarium oxysporum f. sp. lycopersici. Curr. Microbiol. 32: 151-155, 1996.
Camarero S, et al. Preferential degradation of phenolic lignin units by two white rot fungi. Appl. Environ. Microbiol. 60: 4509-4516, 1994. PubMed: 7811086
Caramelo L, et al. A search for ligninolytic peroxidases in the fungus Pleurotus eryngii involving alpha-keto-gamma-thiomethylbutyric acid and lignin model dimers. Appl. Environ. Microbiol. 65: 916-922, 1999. PubMed: 10049842
Ruiz-Duenas FJ, et al. Regulation of peroxidase transcript levels in liquid cultures of the ligninolytic fungus Pleurotus eryngii. Appl. Environ. Microbiol. 65: 4458-4463, 1999. PubMed: 10508075
Ruiz-Duenas FJ, et al. In vitro activation, purification, and characterization of Escherichia coli expressed aryl-alcohol oxidase, a unique H(2)O(2)-producing enzyme. Protein Expr Purif 45: 191-199, 2006. PubMed: 16039872
Camarero S, et al. The cloning of a new peroxidase found in lignocellulose cultures of Pleurotus eryngii and sequence comparison with other fungal peroxidases. FEMS Microbiol Lett 191: 37-43, 2000. PubMed: 11004397
