Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
TAATTTTGAAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC
Nucleotide (GenBank) : KU729073 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU729159 D1/D2 region of 28S rRNA gene
Matern H, et al. Isolation, characterization and localization of the proteinase B inhibitor IB3 from Saccharomyces carlsbergensis. Eur. J. Biochem. 101: 325-332, 1979. PubMed: 118002
Hata S, et al. Involvement of cytochrome P-450 in delta22-desaturation in ergosterol biosynthesis of yeast. Biochem. Biophys. Res. Commun. 103: 272-277, 1981. PubMed: 7032523
Gibian H, et al. Production of optically active antipodes. US Patent 3,562,112 dated Feb 9 1971
Ando T, et al. Novel endo-deoxyribonuclease and process for the production thereof. European Patent Office Publ. No. 0060465A2 dated Sep 9 1982
Nishikawa Y, et al. Thiamine-induced alteration in sterol composition of Saccharomyces carlsbergensis 4228. Biochim. Biophys. Acta 531: 86-95, 1978. PubMed: 708751
Baumstark-Khan C, et al. Radiation induced formation of giant cells in Saccharomyces uvarum. II. Effect of X-rays on septum formation. Radiat. Environ. Biophys. 24: 9-16, 1985. PubMed: 3975354
Tubb RS. 2pm DNA plasmid in brewery yeasts. J Inst Brew 86: 78-80, 1980.
Berge AM. Genes for the fermentation of maltose and -methylglucoside in Saccharomyces carlsbergensis. Mol. Gen. Genet. 115: 80-88, 1972. PubMed: 5018453
Lichko L, Okorokov L. Purification and some properties of membrane-bound and soluble pyrophosphatases of yeast vacuoles. Yeast 7: 805-812, 1991. PubMed: 1664997
Baumstark-Khan C, et al. Radiation induced formation of giant cells (Saccharomyces uvarum). I. Budding process and chitin ring formation. Radiat. Environ. Biophys. 23: 19-30, 1984. PubMed: 6709826
Kreuzberg KH, Betz A. Amplitude and period length of yeast NADH oscillations fermenting on different sugars in dependence of growth phase, starvation and hexose concentration. J Interdiscip Cycle Res 10: 41-50, 1979.
. . Adv. Biotechnol. 2: 225-230, 1981.
Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells in a phosphate limited continuous culture. Biotechnol. Lett. 13: 97-100, 1991.
Jacobsen H, et al. Spontaneous spatio-temporal organization in yeast cell suspension. J. Cell Sci. 43: 367-377, 1980. PubMed: 7419625
Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells. Biotechnol. Lett. 12: 277-282, 1990.
Berge AM, et al. Regulation of maltose fermentation in Saccharomyces carlsbergensis. I. The function of the gene MAL6, as recognized by mal6-mutants. Mol. Gen. Genet. 123: 233-246, 1973. PubMed: 4731427
Das J, Busse HG. Analysis of the dynamics of relaxation type oscillation in glycolysis of yeast extracts. Biophys. J. 60: 369-379, 1991. PubMed: 1832975
AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in food extracts, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.15.
AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in ready-to-feed milk-based infant formula, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 985.32.
Shin M, et al. Effect of L-tryptophan and L-leucine on biosynthesis of niacin-related compounds in Saccharomyces carlsbergensis. J. Nutr. Sci. Vitaminol. 28: 179-189, 1982. PubMed: 6215472
Atkin L, et al. Yeast microbiological methods for determination of vitamins. Pyridoxine. Ind. Eng. Chem. 15: 141-144, 1923.
Appleyard JG, Stanley DA. The evaluation of the vitamin B 6 status in children with convulsions. Med. Lab. Technol. 29: 160-170, 1972. PubMed: 5071462
Itagaki T, Tsukahara T. Microbiological assay of vitamin B 6 by thin-layer cup-plate method with Saccharomyces carlsbergensis. J. Vitaminol. 18: 90-96, 1972.
Windevoxhel M, Bahar S. Production of intracellular alpha-glucosidase in brewery waste by Saccharomyces carlsbergensis. Acta Cient. Venez. 40: 40-45, 1989. PubMed: 2700112
Tsuji K. Liquid nitrogen preservation of Saccharomyces carlsbergensis and its use in a rapid biological assay of pantothenic acid. Appl. Microbiol. 14: 462-465, 1966. PubMed: 5970831
van der Zeijst BA, et al. In vitro protein synthesis in yeast polyuridylic acid-dependent incorporations of phenylalanine into endogenous peptidyl transfer RNA. Biochim. Biophys. Acta 294: 517-526, 1973. PubMed: 4705999
de Kroon RA, Koningsberger VV. An inducible transport system for alpha-glucosides in protoplasts of Saccharomyces carlsbergensis. Biochim. Biophys. Acta 204: 590-609, 1970. PubMed: 5441195
Foodstuffs --- Determination of vitamin B6 by microbiological assay. London, UK:British Standards Institution;British Standard DD ENV 14166:2001.
Stolz J, Vielreicher M. Tpn1p, the plasma membrane vitamin B6 transporter of Saccharomyces cerevisiae. J. Biol. Chem. 278: 18990-18996, 2003. PubMed: 12649274
