Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AAGGATCATTAAAAAAAATTATACACACTGTTTTTGCGAACAAAAAAATAAATCTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCCTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTGCGGGAATTGTAATTTGAAGGTTTCGTGGTCTGAGTCGGCCGCGCCCAAGTCCATTGGAACATGGCGCCTGGGAGGGTGAGAGCCCCGTATGGCGCACGCCGACTCTTTGCACCGCGGCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGTTTTACCGGGCCAGCGTCAAATAAACGGGGGGGAAAAGGGGGAAAGAATGTGGCGCGTGCCTTCGGGTTCGCGTGTTATAGCTTTCTCTAATACCCCCATGTTTGTTTGAGGCCTGCGATTCTAGGACGCTGGCGTAATGGTTGCAAGCCG
Nucleotide (GenBank) : LYUB00000000 Clavispora lusitaniae strain CBS 6936, whole genome shotgun sequencing project
Rodrigues de Miranda L. Clavispora, a new yeast genus of the Saccharomycetales. Antonie van Leeuwenhoek 45: 479-483, 1979. PubMed: 554535
Young LY, et al. A STE12 homolog is required for mating but dispensable for filamentation in Candida lusitaniae. Genetics 155: 17-29, 2000. PubMed: 10790381
Kurtzman CP, Robnett CJ. Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species. FEMS Yeast Res. 13: 23-33, 2013. PubMed: 22978764
Guzman B, Lachance MA, Herrera CM. Phylogenetic analysis of the angiosperm-floricolous insect-yeast association: Have yeast and angiosperm lineages co-diversified? Mol Phylogenet Evol 68: 161-175, 2013. PubMed: 23583418
El-Kirat-Chatel S, Dementhon K, Noel T. A two-step cloning-free PCR-based method for the deletion of genes in the opportunistic pathogenic yeast Candida lusitaniae. Yeast 28: 321-330, 2011. PubMed: 21456057
Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416
Chapeland-Leclerc F, et al. Inactivation of the FCY2 gene encoding purine-cytosine permease promotes cross-resistance to flucytosine and fluconazole in Candida lusitaniae. Antimicrob Agents Chemother 49: 3101-3108, 2005. PubMed: 16048910
Francois F, et al. Development of an integrative transformation system for the opportunistic pathogenic yeast Candida lusitaniae using URA3 as a selection marker. Yeast 21: 95-106, 2004. PubMed: 14755635
Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J Clin Microbiol 42: 5624-5635, 2004. PubMed: 15583292
Lachance MA, et al. The D1/D2 domain of the large-subunit rDNA of the yeast species Clavispora lusitaniae is unusually polymorphic. FEMS Yeast Res 4: 253-258, 2003. PubMed: 14654429
Daniel HM, Sorrell TC, Meyer W. Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. Int J Syst Evol Microbiol 51: 1593-1606, 2001. PubMed: 11491363
Lachance MA, et al. Ribosomal DNA, species structure, and biogeography of the cactophilic yeast Clavispora opuntiae. Can J Microbiol 46: 195-210, 2000. PubMed: 10749533
