<span id="4scry"></span>
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AAGGATCATTAAAATTAATTTATTACACTGTTTTTGAAGCAAACTTACTAATATATTATTTTTCAATTTCTTTTAAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTATCATGACTTGCAGACGTGAATCATCAATCTTTGAACGCACATTGCGCCTTGAGGTATTCCTCAAGGCATGCCTGTTTGAGCGTCGGCTCCCTTCAAACCCCCGGGTTTGGTGTTGCCTTCCGAAATATCACAGTTGTCGCAATACGTTACTTCAACTTTATTCTTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTTCGGGAGTTGTAATTTGTAGGTTGGGAGACCCCGCGGCTAGTGGCACCAAGTCCCTTGGAACAGGGCGCCTTAGAGGGTGAGAGCCCCGTAGATACCACAATACCGTCTTGTGTCTCCTCTCCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGCCTCGTGCCGGGCCAGCATCGGTTGCTAGGGGTGGATAAGGAACAAGGAATGTAGCTCCTCGGAGTATTATAGCCTTGCGCGATACACCCACTGGCGACCGAGGCCTGCGGTATTCCTACCTAGGATGCTGGCGTAATGGTTGCAAGCCG
Nucleotide (GenBank) : AF218968 Candida intermedia strain ATCC 14439T 5.8S ribosomal RNA gene,
Nucleotide (GenBank) : BCGD00000000 Candida intermedia strain JCM 1607, whole genome shotgun sequencing project
Suzuki T, et al. Method of producing citric acid. US Patent 3,733,253 dated May 15 1973
Langeron M, Guerra P. Etudes monographiques sur les Mycotoruloidees. Ann. Parasitol. Hum. Comp. 16: 429-476, 1938.
Ciferri R, Ashford BK. A new species of Blastodendrion. P.R. J. Public Health Trop. Med. 5: 91-105, 1929.
Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891
Guzman B, Lachance MA, Herrera CM. Phylogenetic analysis of the angiosperm-floricolous insect-yeast association: Have yeast and angiosperm lineages co-diversified? Mol Phylogenet Evol 68: 161-175, 2013. PubMed: 23583418
Tsui CK, et al. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. 8: 651-659, 2008. PubMed: 18248416
Diezmann S, et al. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J Clin Microbiol 42: 5624-5635, 2004. PubMed: 15583292
Pryce TM, et al. Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system. Med. Mycol. 41: 369-381, 2003. PubMed: 14653513
Daniel HM, Meyer W. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int. J. Food Microbiol. 86: 61-78, 2003. PubMed: 12892922
Chen YC, et al. Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol. 38: 2302-2310, 2000. PubMed: 10834993
Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281
Kurtzman CP, Robnett CJ. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73(4): 331-371, 1998. PubMed: 9850420
Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410
