
Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. Ref
Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTGAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCG
Nucleotide (GenBank) : KU729052 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : M60307 small subunit ribosomal RNA
Nucleotide (GenBank) : L11352 5.8S ribosomal RNA gene, sequence
Nucleotide (GenBank) : U45754 26S ribosomal RNA gene, partial sequence
Nucleotide (GenBank) : U46004 Candida parapsilosis ribosomal RNA large subunit gene sequence.
Nucleotide (GenBank) : U10987 5.8S rRNA gene and internal transcribed spacers 1 and 2, complete sequence
Nucleotide (GenBank) : AF085429 ADP/ATP carrier protein gene, nuclear gene encoding mitochondrial protein, complete coding sequence
Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150
Ashford BK. Certain conditions of the gastro-intestinal tract in Porto Rico and their relation to tropical sprue. Am. J. Trop. Med. Hyg. 8: 507-538, 1928.
Lott TJ, et al. Genomic heterogeneity in the yeast Candida parapsilosis. Curr. Genet. 23: 463-467, 1993. PubMed: 8319303
Briand D, et al. Functioning and regioselectivity of the lipase of Candida parapsilosis (Ashford) Langeron and Talice in aqueous medium. New interpretation of regioselectivity taking acyl migration into account. Eur. J. Biochem. 228: 169-175, 1995. PubMed: 7883000
Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891
Lott TJ, et al. Nucleotide sequence analysis of the 5-8S rDNA and adjacent ITS2 region of Candida albicans and related species. Yeast 9: 1199-1206, 1993. PubMed: 8109169
Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585
Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747
Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752
Lin D, et al. Three distinct genotypes within Candida parapsilosis from clinical sources. J. Clin. Microbiol. 33: 1815-1821, 1995. PubMed: 7665651
Yamamoto H, et al. Purification and characterization of (S)-1,3-butanediol dehydrogenase from Candida parapsilosis. Biosci. Biotechnol. Biochem. 59: 1769-1770, 1995. PubMed: 8520120
Briand D, et al. Factors affecting the acyltransfer activity of the lipase from Candida parapsilosis in aqueous media. J. Am. Oil Chem. Soc. 72: 1367-1373, 1995.
Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089
Nebohacova M, et al. Isolation and expression of the gene encoding mitochondrial ADP/ATP carrier (AAC) from the pathogenic yeast Candida parapsilosis. Yeast 15: 1237-1242, 1999. PubMed: 10487926
Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410
Barns SM, et al. Evolutionary relationships among pathogenic Candida species and relatives. J. Bacteriol. 173: 2250-2255, 1991. PubMed: 2007550
Middelhoven WJ, et al. Degradation of some phenols and hydroxybenzoates by the imperfect ascomycetous yeasts Candida parapsilosis and Arxula adeninivorans: evidence for an operative gentisate pathway. Antonie van Leeuwenhoek 62: 181-187, 1992. PubMed: 1416914
Sensititre™ YeastOne. Thermo Scientific™ Sensititre™ Systems, Trek Diagnostic Systems.
Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3.
Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.
Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002
VITEK 2 Antifungal AST Card. bioMerieux.
Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.
VITEK 2 AST-YS QC Set. bioMerieux.
Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.
Abi-Chacra EA, et al. Phenotypical properties associated with virulence from clinical isolates belonging to the Candida parapsilosis complex. FEMS Yeast Res. 13: 831-848, 2013. PubMed: 24103069
Bisha B, Kim HJ, Brehm-Stecher BF. Improved DNA-FISH for cytometric detection of Candida spp. J Appl Microbiol 110: 881-892, 2011. PubMed: 21205104
Cornet M, et al. Molecular identification of closely related Candida species using two ribosomal intergenic spacer fingerprinting methods. J Mol Diagn 13: 12-22, 2011. PubMed: 21227390
Gunisova S, et al. Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA 15: 546-559, 2009. PubMed: 19223441
Borman AM, et al. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46: 933-938, 2008. PubMed: 18199788
Kosa P, Gavenciakova B, Nosek J. Development of a set of plasmid vectors for genetic manipulations of the pathogenic yeast Candida parapsilosis. Gene 396: 338-345, 2007. PubMed: 17512139
Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340
Kosa P, et al. Complete DNA sequences of the mitochondrial genomes of the pathogenic yeasts Candida orthopsilosis and Candida metapsilosis: insight into the evolution of linear DNA genomes from mitochondrial telomere mutants. Nucleic Acids Res. 34: 2472-2481, 2006. PubMed: 16684995
